ID: 920296473_920296478

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 920296473 920296478
Species Human (GRCh38) Human (GRCh38)
Location 1:204960378-204960400 1:204960408-204960430
Sequence CCACTCTGCCTATGCTGTAACAG GTGCCTCCTGATGCAATAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155} {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!