ID: 920301085_920301093

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 920301085 920301093
Species Human (GRCh38) Human (GRCh38)
Location 1:204989506-204989528 1:204989537-204989559
Sequence CCCGCACACGCACTGGCATCAGG CAGTCTGGGACCTCTCGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 154} {0: 1, 1: 0, 2: 1, 3: 7, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!