ID: 920327747_920327752

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 920327747 920327752
Species Human (GRCh38) Human (GRCh38)
Location 1:205179877-205179899 1:205179925-205179947
Sequence CCATCCATCCTCTACTCAGAAGG AAAACAGAAAGGAAGCCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 253} {0: 1, 1: 1, 2: 5, 3: 62, 4: 768}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!