ID: 920339184_920339195

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 920339184 920339195
Species Human (GRCh38) Human (GRCh38)
Location 1:205265069-205265091 1:205265115-205265137
Sequence CCTTCATGTCACCAAGGAGGTGT AGGAGCTGGTGTCCTGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 218} {0: 1, 1: 1, 2: 2, 3: 34, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!