ID: 920357008_920357010

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 920357008 920357010
Species Human (GRCh38) Human (GRCh38)
Location 1:205381177-205381199 1:205381208-205381230
Sequence CCTTGCTAAGTTTCAAAGGCAAA CCTGTTCTAAATTGTTTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 347} {0: 1, 1: 0, 2: 1, 3: 20, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!