ID: 920400123_920400129

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 920400123 920400129
Species Human (GRCh38) Human (GRCh38)
Location 1:205670996-205671018 1:205671030-205671052
Sequence CCTGTCTGAGAGCTCCAGTCCAG AAACAAATGCCAGAGGAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 150} {0: 1, 1: 1, 2: 0, 3: 40, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!