ID: 920400127_920400129

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 920400127 920400129
Species Human (GRCh38) Human (GRCh38)
Location 1:205671015-205671037 1:205671030-205671052
Sequence CCAGCTTTGGAAAGGAAACAAAT AAACAAATGCCAGAGGAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 356} {0: 1, 1: 1, 2: 0, 3: 40, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!