ID: 920482321_920482331

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 920482321 920482331
Species Human (GRCh38) Human (GRCh38)
Location 1:206334507-206334529 1:206334557-206334579
Sequence CCCAGGGACGGGTATTTGGGAGG CTCAGTGGCTTATTGCTATTTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 10, 4: 107} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!