ID: 920512311_920512328

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 920512311 920512328
Species Human (GRCh38) Human (GRCh38)
Location 1:206560331-206560353 1:206560382-206560404
Sequence CCCAAGACTCCTCTCCAATGCCC GGTCTCCCCATTTCATAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 224} {0: 1, 1: 0, 2: 2, 3: 16, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!