ID: 920627396_920627397

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 920627396 920627397
Species Human (GRCh38) Human (GRCh38)
Location 1:207615913-207615935 1:207615931-207615953
Sequence CCTAAATTCATATCAAACTAGAA TAGAAGCATCAATTGCTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 102, 4: 793} {0: 1, 1: 1, 2: 1, 3: 20, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!