ID: 920631613_920631621

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 920631613 920631621
Species Human (GRCh38) Human (GRCh38)
Location 1:207658676-207658698 1:207658713-207658735
Sequence CCTGGTTTCTGCAGAGATCCTGT CCCGCCACACAGGAGCCAGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 209} {0: 1, 1: 0, 2: 2, 3: 33, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!