ID: 920704517_920704526

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 920704517 920704526
Species Human (GRCh38) Human (GRCh38)
Location 1:208241955-208241977 1:208241999-208242021
Sequence CCTCCAGGCCACCACCAAGGAGA ATGGTGCTCCGTGAAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 301} {0: 1, 1: 0, 2: 2, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!