ID: 920751330_920751334

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 920751330 920751334
Species Human (GRCh38) Human (GRCh38)
Location 1:208680220-208680242 1:208680239-208680261
Sequence CCTGGGCAAGCTCCGCAGGATGA ATGAGGGAGTATAAAGAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!