ID: 920845582_920845591

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 920845582 920845591
Species Human (GRCh38) Human (GRCh38)
Location 1:209590591-209590613 1:209590630-209590652
Sequence CCTCCTGGAGAACAGGCCGTCAT AAGAGGGAGTGATGGACGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86} {0: 1, 1: 0, 2: 1, 3: 11, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!