ID: 920862923_920862926

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 920862923 920862926
Species Human (GRCh38) Human (GRCh38)
Location 1:209725572-209725594 1:209725607-209725629
Sequence CCAGCTGTCATTGTGGGACTTTA GACCTCTCCCCATTTCTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!