ID: 920866295_920866303

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 920866295 920866303
Species Human (GRCh38) Human (GRCh38)
Location 1:209756680-209756702 1:209756700-209756722
Sequence CCCTCTCCCCTCAGTTCACACTG CTGAGAGCTCTGGGCCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 362} {0: 1, 1: 0, 2: 3, 3: 59, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!