ID: 920912572_920912577

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 920912572 920912577
Species Human (GRCh38) Human (GRCh38)
Location 1:210232622-210232644 1:210232640-210232662
Sequence CCTGAGGAGCGGCGGCGGCGGCC CGGCCTGAGCAGAGGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 83, 4: 490} {0: 1, 1: 0, 2: 4, 3: 84, 4: 622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!