ID: 920927007_920927014

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 920927007 920927014
Species Human (GRCh38) Human (GRCh38)
Location 1:210351256-210351278 1:210351294-210351316
Sequence CCTCCTTTTGTTCTATTTAGACC GGTGCCCACCTGCATTAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 23, 3: 65, 4: 257} {0: 1, 1: 0, 2: 3, 3: 6, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!