ID: 920932934_920932943

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 920932934 920932943
Species Human (GRCh38) Human (GRCh38)
Location 1:210406025-210406047 1:210406058-210406080
Sequence CCAACCTCCTGAATCACAGCCTC GCCCAGGAAGGTGGTTTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 355} {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!