ID: 920945877_920945884

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 920945877 920945884
Species Human (GRCh38) Human (GRCh38)
Location 1:210528179-210528201 1:210528203-210528225
Sequence CCTACAAGTGTGTGTCACAATGC CCAGACCCAGGGGTGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 224} {0: 1, 1: 0, 2: 5, 3: 34, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!