ID: 921000765_921000769

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 921000765 921000769
Species Human (GRCh38) Human (GRCh38)
Location 1:211040391-211040413 1:211040429-211040451
Sequence CCTGAGCTATTCTCGTGATAGTG ATCTGATGATGGGTTTATTAGGG
Strand - +
Off-target summary {0: 2, 1: 129, 2: 1065, 3: 3979, 4: 8707} {0: 1, 1: 0, 2: 1, 3: 25, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!