ID: 921029703_921029719

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 921029703 921029719
Species Human (GRCh38) Human (GRCh38)
Location 1:211326766-211326788 1:211326802-211326824
Sequence CCTCCGCCCGCGCCCCGGCCCCG CTCCGCTTCGCCGCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 84, 3: 670, 4: 2832} {0: 1, 1: 0, 2: 2, 3: 26, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!