ID: 921106597_921106611

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 921106597 921106611
Species Human (GRCh38) Human (GRCh38)
Location 1:211987036-211987058 1:211987086-211987108
Sequence CCTGTAACCCCAGCACTTTGAAA CAGGAGTTTCAGACCAGCTTGGG
Strand - +
Off-target summary {0: 11, 1: 1021, 2: 26569, 3: 321206, 4: 259823} {0: 37, 1: 1836, 2: 27036, 3: 64311, 4: 62264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!