ID: 921199532_921199544

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 921199532 921199544
Species Human (GRCh38) Human (GRCh38)
Location 1:212791968-212791990 1:212792001-212792023
Sequence CCGCCCCGGACTTTGACCGCGTA ATACGGGACCAGAGGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 8} {0: 1, 1: 0, 2: 0, 3: 16, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!