ID: 921207170_921207179

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 921207170 921207179
Species Human (GRCh38) Human (GRCh38)
Location 1:212858610-212858632 1:212858628-212858650
Sequence CCCGGGACAGCCTCGCTGCCGCC CCGCCTCGGGAGTTCTGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 1378} {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!