ID: 921330446_921330457

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 921330446 921330457
Species Human (GRCh38) Human (GRCh38)
Location 1:214030485-214030507 1:214030534-214030556
Sequence CCATTTCAGTGAAGATCATTTCA TTTTTAAAGGGGATTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 289} {0: 1, 1: 0, 2: 4, 3: 47, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!