ID: 921372728_921372732

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 921372728 921372732
Species Human (GRCh38) Human (GRCh38)
Location 1:214441488-214441510 1:214441504-214441526
Sequence CCAACTGAATGTCCCAATGCTGA ATGCTGATATTCAGGAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118} {0: 1, 1: 0, 2: 1, 3: 31, 4: 643}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!