ID: 921429703_921429706

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 921429703 921429706
Species Human (GRCh38) Human (GRCh38)
Location 1:215051229-215051251 1:215051253-215051275
Sequence CCATGCATGGATCTTAATATTAA AATTTTATGTGGAAGATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 228} {0: 1, 1: 1, 2: 1, 3: 26, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!