ID: 921501458_921501460

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 921501458 921501460
Species Human (GRCh38) Human (GRCh38)
Location 1:215909276-215909298 1:215909298-215909320
Sequence CCAGGGGTTGGGGGAGGGCTGTA ATGAATGAATAGATGGAACACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 120, 4: 767} {0: 1, 1: 1, 2: 9, 3: 121, 4: 848}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!