ID: 921504022_921504024

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 921504022 921504024
Species Human (GRCh38) Human (GRCh38)
Location 1:215944154-215944176 1:215944168-215944190
Sequence CCAAATTTGGCCAGCTGCCTATT CTGCCTATTTTTGTAAATAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 114, 4: 414} {0: 2, 1: 6, 2: 18, 3: 40, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!