ID: 921521662_921521664

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 921521662 921521664
Species Human (GRCh38) Human (GRCh38)
Location 1:216163435-216163457 1:216163475-216163497
Sequence CCATATATCTGAATTACTTGAGG ATTTTATTTATCTTATCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 153} {0: 1, 1: 0, 2: 17, 3: 177, 4: 1651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!