ID: 921570076_921570079

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 921570076 921570079
Species Human (GRCh38) Human (GRCh38)
Location 1:216767198-216767220 1:216767239-216767261
Sequence CCTTTCTTTCCTAGTTACTCATA CTTCTAAAAAAAGAAAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 288} {0: 1, 1: 2, 2: 41, 3: 566, 4: 5576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!