ID: 921595111_921595114

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 921595111 921595114
Species Human (GRCh38) Human (GRCh38)
Location 1:217046267-217046289 1:217046302-217046324
Sequence CCTATAGCACCTAGCACAGTATC GATGATCAAGAAATAGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 56, 4: 316} {0: 1, 1: 0, 2: 1, 3: 27, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!