ID: 921640563_921640570

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 921640563 921640570
Species Human (GRCh38) Human (GRCh38)
Location 1:217547789-217547811 1:217547821-217547843
Sequence CCAAATCTCATCTCGAATTGTAA GTCAGAGGAGGTCTGGCGGCGGG
Strand - +
Off-target summary {0: 355, 1: 3839, 2: 11950, 3: 12661, 4: 10322} {0: 1, 1: 0, 2: 1, 3: 9, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!