ID: 921659421_921659424

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 921659421 921659424
Species Human (GRCh38) Human (GRCh38)
Location 1:217782178-217782200 1:217782196-217782218
Sequence CCTTCCGAGATATCACCGAAGTA AAGTATTAGAACAACGCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30} {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!