ID: 921827489_921827490

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 921827489 921827490
Species Human (GRCh38) Human (GRCh38)
Location 1:219689800-219689822 1:219689828-219689850
Sequence CCTACAAGCATTTTTGAACACTT GTACCAGACATTAAACTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 260} {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!