ID: 921839128_921839137

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 921839128 921839137
Species Human (GRCh38) Human (GRCh38)
Location 1:219809751-219809773 1:219809782-219809804
Sequence CCAGCCGCCACCGCATTTCCTGC CTGCATATCAGGTTTGGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!