ID: 921932907_921932913

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 921932907 921932913
Species Human (GRCh38) Human (GRCh38)
Location 1:220769708-220769730 1:220769753-220769775
Sequence CCCTCAAGTTGTTTAACTCCCTG TCTTTCTCTCTGTGTATGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 140} {0: 1, 1: 0, 2: 25, 3: 126, 4: 905}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!