ID: 921937270_921937279

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 921937270 921937279
Species Human (GRCh38) Human (GRCh38)
Location 1:220806775-220806797 1:220806814-220806836
Sequence CCAGAGTGTGGGCCAGGCTGCAG CCATGAGGGCCTAGGCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 356} {0: 1, 1: 0, 2: 0, 3: 23, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!