ID: 922226238_922226243

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 922226238 922226243
Species Human (GRCh38) Human (GRCh38)
Location 1:223648283-223648305 1:223648307-223648329
Sequence CCCCCTGGGCCACATGGAGCTGT ATCTGCAGTTTTTCCCACCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 136, 4: 1240} {0: 1, 1: 0, 2: 3, 3: 16, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!