ID: 922308307_922308311

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 922308307 922308311
Species Human (GRCh38) Human (GRCh38)
Location 1:224363943-224363965 1:224363978-224364000
Sequence CCAAGTTCCTTCATGGAGGATAT AGTGTACTGAGAACAAATTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139} {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!