ID: 922316256_922316261

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922316256 922316261
Species Human (GRCh38) Human (GRCh38)
Location 1:224445045-224445067 1:224445066-224445088
Sequence CCCGTGAAACCATCACCCAGGTC TCATGAAATAGAACGTTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 92, 4: 753} {0: 1, 1: 0, 2: 1, 3: 12, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!