ID: 922339392_922339395

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 922339392 922339395
Species Human (GRCh38) Human (GRCh38)
Location 1:224643477-224643499 1:224643499-224643521
Sequence CCTGGTGGGACAGTGAGTGGGTC CATGAAGGCAAGGCCTGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 199} {0: 1, 1: 0, 2: 0, 3: 5, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!