|
Left Crispr |
Right Crispr |
Crispr ID |
922406955 |
922406956 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:225324074-225324096
|
1:225324091-225324113
|
Sequence |
CCAAAGTGCTGGGTTTATAGGCA |
TAGGCATGAGCCGCCGCCCCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 80, 1: 11361, 2: 115881, 3: 246138, 4: 241323} |
{0: 1, 1: 37, 2: 1673, 3: 21509, 4: 96914} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|