ID: 922461263_922461271

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 922461263 922461271
Species Human (GRCh38) Human (GRCh38)
Location 1:225815962-225815984 1:225816000-225816022
Sequence CCCCTGGAATAGGAGCCTCTCTC TGCCAAGGACTGGCCCGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 216} {0: 1, 1: 0, 2: 0, 3: 30, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!