ID: 922464370_922464374

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922464370 922464374
Species Human (GRCh38) Human (GRCh38)
Location 1:225836700-225836722 1:225836737-225836759
Sequence CCGCATGATTCCACCTATAGAAG CAAACTCAGCAGAAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 203} {0: 1, 1: 1, 2: 0, 3: 27, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!