ID: 922556022_922556031

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 922556022 922556031
Species Human (GRCh38) Human (GRCh38)
Location 1:226532700-226532722 1:226532744-226532766
Sequence CCTTCCCTCTTCCCACTGGCTGG ACAGCCCTTCCTGGCATCCTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 8, 3: 60, 4: 634} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!