ID: 922610481_922610488

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 922610481 922610488
Species Human (GRCh38) Human (GRCh38)
Location 1:226923490-226923512 1:226923513-226923535
Sequence CCCCAGAGGCAGAAAGCCAAGGG AAGAGTTGGAGAAATGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 39, 4: 410} {0: 1, 1: 1, 2: 2, 3: 23, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!