ID: 922712434_922712441

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 922712434 922712441
Species Human (GRCh38) Human (GRCh38)
Location 1:227844303-227844325 1:227844327-227844349
Sequence CCCTGTCTGATCAAGGCTTCCTC CCTACCCCCCATGAGTGGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!