ID: 922730740_922730754

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 922730740 922730754
Species Human (GRCh38) Human (GRCh38)
Location 1:227947758-227947780 1:227947801-227947823
Sequence CCCACCAGTGCGCGCCGGCCGCC GGCGGCCGAAGGGCGCAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 72} {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!